View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070A-Insertion-4 (Length: 343)
Name: NF3070A-Insertion-4
Description: NF3070A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070A-Insertion-4 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 8 - 343
Target Start/End: Complemental strand, 37335212 - 37334877
Alignment:
| Q |
8 |
gcttgaagtgaggggagttttcagggcaagatcaaaactaggaaccatcttaaggtattcatataacctttatggccgttgcagtatcatggtggcacgc |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37335212 |
gcttgaagtgaggggggttttcagggcaagatcaaaactaggaaccatcttaaggtattcatataacctttatggccgttgcagtatcatggtggcacgc |
37335113 |
T |
|
| Q |
108 |
cctcctgaagggataatgatgaaaaggaagtgcagaacgaaacgctgatatggtaacacttatattgtaacattggtattcttttttgtccttgaaaatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37335112 |
cctcctgaagggataatgatgaaaaggaagtgcagaacgaaacgctgatatggtaacacttatattgtaacattggtattcttttttgtccttgaaaatt |
37335013 |
T |
|
| Q |
208 |
tgggggattttggttttactattttgcctattcctcctacgaataacatcttaaggagttaacatctaaattttaattcatgaacatgtagtttttctta |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37335012 |
tgggggattttggttttactattttgcctattcctcctacgaataacatcttaaggagttaacatttaaattttaattcatgaacatgtagtttttctta |
37334913 |
T |
|
| Q |
308 |
aactacaaacttgtatcacaattttttctgcactag |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37334912 |
aactacaaacttgtatcacaattttttctgcgctag |
37334877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University