View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070A-Insertion-8 (Length: 249)
Name: NF3070A-Insertion-8
Description: NF3070A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070A-Insertion-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 30 - 249
Target Start/End: Original strand, 6356060 - 6356279
Alignment:
| Q |
30 |
acatctatcatatcactctttctagcatattattatacatcctttctctgtcgaggttctcttacccttgacatctgtcataactctggtaagtcctttc |
129 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||| ||||||||||||| |||| ||| |||| |||||||||||||||||||||| ||||| |
|
|
| T |
6356060 |
acatctatcatatcactctctctagcgtattattatacatcatttctctgtcgagcctctcaaacctttgagatctgtcataactctggtaagttctttc |
6356159 |
T |
|
| Q |
130 |
gtacccaattcacttggatatatttttagttttggtactatacatcttcctccggaactgttgaggcttgaagcctgtaccttttctcttctcgaccata |
229 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
6356160 |
gtacccaattcacttaaatatatttttagttttggtactatacatcttcctcgtgaactgttgaggcttaaagcctgtaccttttctcttctcgaccaga |
6356259 |
T |
|
| Q |
230 |
acagctcgtacctttctcta |
249 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6356260 |
acagctcgtacctttctcta |
6356279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University