View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070R-Insertion-7 (Length: 126)
Name: NF3070R-Insertion-7
Description: NF3070R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070R-Insertion-7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 9 - 121
Target Start/End: Original strand, 250497 - 250609
Alignment:
| Q |
9 |
cctctcccatcatctctttcaacaaactctgaaggtaacgcacttcatgctttcagaaccagactttctgatcccaacaacgtccttcaaagctgggacc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
250497 |
cctctcccatcatctctttcaacaaactctgaaggtaacgcacttcatgctttcagaaccagactttctgatcccaacaacgtccttcaaagctgggacc |
250596 |
T |
 |
| Q |
109 |
ctactcttgttaa |
121 |
Q |
| |
|
||||||||||||| |
|
|
| T |
250597 |
ctactcttgttaa |
250609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University