View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070_high_12 (Length: 334)
Name: NF3070_high_12
Description: NF3070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 15 - 327
Target Start/End: Original strand, 24355172 - 24355484
Alignment:
| Q |
15 |
tgaagtgcactgcagaaggaatagatggaggaatgtttgtgggaaggaaaagtagagaaaatggtattgttgttagtattgctgagaggtataaggttgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24355172 |
tgaagtgcactgcagaaggaatagatggaggaatgtttgtgggaaggaaaagtagagaaaatggcattgttgttagtattcctgagaggtataaggttgt |
24355271 |
T |
 |
| Q |
115 |
gttgttgttggcatgtgttatgtgtctttgtaatgctgatcgcgttgtcatgtcggttgctgttgttcctcttgctgctaaacatggttggtctagttct |
214 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24355272 |
gttattgttggcatgtgttatgtgtctttgtaacgctgaccgtgttgtcatgtcggttgctgttgttcctcttgctgctaaacatggttggtctagttct |
24355371 |
T |
 |
| Q |
215 |
ttccttggcattgttcaggtaccaataatattgattccaaatcttctgatcatgaatatacgtgttccgtgtccaacacatctagttatattcgatcgtg |
314 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24355372 |
tttcttggcattgttcaggtaccaataatattgattccaaatcttctgatcatgaatatacgtgttccgtgtccaaaacatctagttatattcgatcgtg |
24355471 |
T |
 |
| Q |
315 |
tgttttgtctgtg |
327 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24355472 |
tgttttgtctgtg |
24355484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University