View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070_high_19 (Length: 302)
Name: NF3070_high_19
Description: NF3070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 6 - 264
Target Start/End: Original strand, 480134 - 480392
Alignment:
| Q |
6 |
agtgatatgaataagtggagcagtatctattgcattgttgaagggtccaaagctactaataaatgcagagaacataacttcaaagtcaatcatggcaaga |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
480134 |
agtgatatgtataagtggagcagtatctattgcattgttgaagggtccaaagctactaataaatgcagagaacataacttcaaagtcaatcatggcaaga |
480233 |
T |
 |
| Q |
106 |
ctctctagtaatgatgagaattggttgcttggatgtctttgtcttttaggaaactgtgttgcttggtcaatttggctcattttgcaggtatagtatgtta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
480234 |
ctctctagtaatgatgagaattggttgcttggatgtctttgtcttttaggaaactgtgttgcttggtcaatttggctcattttgcaggtatagtatgtta |
480333 |
T |
 |
| Q |
206 |
tttcaatatcaaaacacatatcatatatatgcgttaaggttttggatcaacatgtaata |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
480334 |
tttcaatatcaaaacacatatcatatatatgcgttaaggttttggatcaacatgtaata |
480392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 196
Target Start/End: Original strand, 474801 - 474977
Alignment:
| Q |
20 |
gtggagcagtatctattgcattgttgaagggtccaaagctactaataaatgcagagaacataa---cttcaaagtcaatcatggcaagactctctagtaa |
116 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||||||||||||| ||||||| |||||| || |||| || |||||||| | | ||| ||| |
|
|
| T |
474801 |
gtggagcattgtctatagcattgttgaagggtccaaagctactaa---atgcagaaaacatactacctacaaaatctatcatggccataacctccggtag |
474897 |
T |
 |
| Q |
117 |
tgatgagaattggttgcttggatgtctttgtcttttaggaaactgtgttgcttggtcaatttggctcattttgcaggtat |
196 |
Q |
| |
|
|||||| | |||||||||||||||| | | |||||| |||| ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
474898 |
tgatgatagttggttgcttggatgtgtgtatcttttgggaagtagtgttgcctggtcactttggctcattttgcaggtat |
474977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 467764 - 467943
Alignment:
| Q |
17 |
taagtggagcagtatctattgcattgttgaagggtccaaagctactaataaatgcagagaacataacttcaaagtcaatcatggcaaga--ctctctagt |
114 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||| |||| |||||||||| || ||| |||||| ||||||||||| | | || ||| |
|
|
| T |
467764 |
taagtggagcagtgtcaattgcattgttgaagggtccaaa---actactaaatgcagataagatactttcaaaatcaatcatggccacaaccttattagg |
467860 |
T |
 |
| Q |
115 |
aa-tgatgagaattggttgcttggatgtctttgtcttttaggaaactgtgttgcttggtcaatttggctcattttgcaggtat |
196 |
Q |
| |
|
|| ||||||||||||||||||||||||||| | |||| | ||| | |||||||||| ||||| |||||||||||||||| |
|
|
| T |
467861 |
aagtgatgagaattggttgcttggatgtctgtctcttctcggatgcactgttgcttggggaatttttctcattttgcaggtat |
467943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 27491576 - 27491400
Alignment:
| Q |
17 |
taagtggagcagtatctattgcattgttgaagggtccaaagctactaataaatgcagagaacataacttcaaagtcaatcat-ggcaagactctctagta |
115 |
Q |
| |
|
||||||||||||| | |||||| | ||||||||||||||||| |||| ||||||| | |||||||||||| |||||||| |||| || || ||| | |
|
|
| T |
27491576 |
taagtggagcagtgttcattgcactattgaagggtccaaagctgctaa---atgcagaaagcataacttcaaaatcaatcattggcacaac-ct-tagga |
27491482 |
T |
 |
| Q |
116 |
a-tgatgagaattggttgcttggatgtctttgtcttttaggaaactgtgttgcttggtcaatttggctcattttgcaggtat |
196 |
Q |
| |
|
| ||||||||||||||||||||||||| | |||||| |||| ||||||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
27491481 |
agtgatgagaattggttgcttggatgtttggttctttttggaagctgtgttgcctggtcagtttggcttattttgcaggtat |
27491400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University