View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070_high_20 (Length: 283)
Name: NF3070_high_20
Description: NF3070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070_high_20 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 14 - 283
Target Start/End: Complemental strand, 3553151 - 3552881
Alignment:
| Q |
14 |
atatagagatgttgaaagtttggtgtgtgttttttgtagcatcggtcaagactcaagagtcagatcgacgtcttttcgttacctataacttatcaccaca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
3553151 |
atatagagatgttgaaagtttggtgtgtgttttttgtagcatcaatcaagactcaagattcagatcgatgtctttttgttacctatgacttatcaccaca |
3553052 |
T |
 |
| Q |
114 |
aagtatggtataaagttatgtgatggtttaggtcggggcgagtcatatctcctaatttattccgattattctcc-nnnnnnnnctttggagttaattgat |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||| ||||||||||||||| | |
|
|
| T |
3553051 |
aagtatggtataaaattatgtgatggtttaggtcggagcgagtcatatctcctaccttatttcgattattctcctttttttttctttggagttaattggt |
3552952 |
T |
 |
| Q |
213 |
tctcaactaaaaactttgtttggagttagtttcacattggaagtcacgaagtaacattattttctctaata |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3552951 |
tctcaactaaaaactttgtttggagttagtttcacattggaagtcacgaagtaacattattttctctaata |
3552881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University