View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070_high_25 (Length: 253)
Name: NF3070_high_25
Description: NF3070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 3552891 - 3552655
Alignment:
| Q |
1 |
tttctctaataagtt-atcccatttaagcaattatggtgaattgaattaaattatcttc---aaatgagtttttgggtaaaaaacactgggggtccactt |
96 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3552891 |
tttctctaataagtttatcccatttaagcaatt--ggtgaattgaattaaattatcttcttcaaatgagtttttgggtaaaaaacactgggg-tccactt |
3552795 |
T |
 |
| Q |
97 |
gcactttctaaaagtgggcaatgcaaccctacattgtttgttgagatagtccttagttggtcaaatggctatttgtaggggttatcatttatcttgttcg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3552794 |
gcactttctaaaagtgggcaatgcaaccctacattgtttgttgagatagtccttggttggtcaaatggctatttgtaggggttatcatttatcttgttcg |
3552695 |
T |
 |
| Q |
197 |
ctaattggcggggttatactttaacctgtcatgcaattag |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3552694 |
ctaattggcggggttatactttaacctgtcatgcaattag |
3552655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University