View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3070_high_34 (Length: 235)

Name: NF3070_high_34
Description: NF3070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3070_high_34
NF3070_high_34
[»] chr4 (2 HSPs)
chr4 (122-235)||(39513384-39513497)
chr4 (17-68)||(39513504-39513555)
[»] chr1 (1 HSPs)
chr1 (120-152)||(35335972-35336004)


Alignment Details
Target: chr4 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 235
Target Start/End: Complemental strand, 39513497 - 39513384
Alignment:
122 actaaatcacaacacaactttttgtctcaaatatttg--gttgaaaataccaaaatagtcttttgtcgacaaagatttataacaaaatattgttgaatac 219  Q
    ||||||| ||| |||||||||||||||||||||| |   || ||||| ||||||||||||||||||||||||| |||||||| |||  ||| || ||||     
39513497 actaaataacagcacaactttttgtctcaaatatatattgtcgaaaacaccaaaatagtcttttgtcgacaaaaatttataataaa--attattcaatat 39513400  T
220 cataaaaatttatatt 235  Q
    ||||||||||||||||    
39513399 cataaaaatttatatt 39513384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 68
Target Start/End: Complemental strand, 39513555 - 39513504
Alignment:
17 atatcgattaaattttgtcttgtacaatgtttgattgtaaaattgctctatg 68  Q
    |||| ||||||||||||||||||||||||||||||  |||| || |||||||    
39513555 atattgattaaattttgtcttgtacaatgtttgatcttaaagtttctctatg 39513504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 152
Target Start/End: Original strand, 35335972 - 35336004
Alignment:
120 tcactaaatcacaacacaactttttgtctcaaa 152  Q
    |||||||| ||||||||||||||||||||||||    
35335972 tcactaaagcacaacacaactttttgtctcaaa 35336004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University