View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070_low_1 (Length: 817)
Name: NF3070_low_1
Description: NF3070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-105
Query Start/End: Original strand, 562 - 803
Target Start/End: Complemental strand, 4235346 - 4235104
Alignment:
| Q |
562 |
tgaagactaattagccctatagattgatttagagatggtat-atcagttgtactatggtagactaataaagaaaatatgcaggattcttagaagcaaatc |
660 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||| ||| ||| || ||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4235346 |
tgaagattaattagccatatagagtgatttagatatgctattattggttgtactatgatagactaataaagaaaatatgcaggattgttagaagcaaatc |
4235247 |
T |
 |
| Q |
661 |
atcatgtaaatgttagaaataacaaaataaacgctgctaaactgtttcaatgacttttctctatataacgacggatcatggtgtatactttgtgaatgta |
760 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4235246 |
atcatgtaaatgttagaaataacaaaataaacgctgctaaactgtttcaatgacttttctctatataacgacggatcatgctgtatactttgtgaatgta |
4235147 |
T |
 |
| Q |
761 |
ttttaggttcttttatacgacacttttaatgctatcactactt |
803 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4235146 |
ttttaggttcttttatacgacacttttaatgctatcactactt |
4235104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University