View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070_low_10 (Length: 373)
Name: NF3070_low_10
Description: NF3070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 51 - 243
Target Start/End: Complemental strand, 6864118 - 6863928
Alignment:
| Q |
51 |
tgacagcacgcttgaaggttgttgcagctcacttcaacgttgatcagttccatttcagctcacattttgtctatttctttcattaggattatttatgtct |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6864118 |
tgacagcacgcttgaaggttgttgcagctcacttcaacgttgatcagttccatttcagctcacattttgtctatttctttcattaggattattt--gtct |
6864021 |
T |
|
| Q |
151 |
agataaaaagttagatagttcagtttatttaaacttgttcttaatttatctttgattcgtgctatatttggagataagacaacttaaatatga |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6864020 |
agataaaaagttagatagttcagtttatttaaacttgttcttaatttatctttgattcgtgctatatttggagataagacaacttaaatatga |
6863928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 23 - 97
Target Start/End: Original strand, 20339702 - 20339777
Alignment:
| Q |
23 |
atgttacttgtggtgtaggcttgtat-gatgacagcacgcttgaaggttgttgcagctcacttcaacgttgatcag |
97 |
Q |
| |
|
||||||| | ||||||||| |||||| || | ||||||| ||||||||||||||||| || |||||||||| |||| |
|
|
| T |
20339702 |
atgttacctttggtgtagggttgtattgagggcagcacggttgaaggttgttgcagcccagttcaacgttggtcag |
20339777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University