View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070_low_31 (Length: 255)
Name: NF3070_low_31
Description: NF3070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070_low_31 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 255
Target Start/End: Original strand, 49475752 - 49475984
Alignment:
| Q |
19 |
gaaaacaaaacataagaacactgttacagtgacaatttgcaaatttgtacttttgcagctgatcttcatggtatctgatagactcgcaataataaagaga |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
49475752 |
gaaaacaaaacataagaacactgttacggtgacaatttgcaaatttgtacttttgcagctgatcttcatggtatctgatagactcgcaataataaagaaa |
49475851 |
T |
 |
| Q |
119 |
aaaggaaggaactaacggcaacttgtaaataaactgtagataaattaggagttagttgagaactaagtgaggactgtagaggtgcgtgggttctcctaaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49475852 |
aaaggaaggaactaacggcaacttgtaaataaactgtagataaattaggagttagttgagaactaagtgaggactgtagag----atgggttctcctaaa |
49475947 |
T |
 |
| Q |
219 |
aatcaccttacactgtattctccctggttgcattgac |
255 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49475948 |
aatcacctcacactgtattctccctggttgcattgac |
49475984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University