View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070_low_38 (Length: 238)
Name: NF3070_low_38
Description: NF3070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 18 - 156
Target Start/End: Original strand, 43393973 - 43394113
Alignment:
| Q |
18 |
aaatttttcgccgtcatcttagtttgagtggataaaggctccataccgttgtagttcatttgcagcaagttccgacagtagtaatagaaaatataac--a |
115 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
43393973 |
aaatttttcggcgtcatcttagtttgggtggataaaggctccataccgttgcagttcatttgcagcaagttccaacagtagtaatagaaaatataacaaa |
43394072 |
T |
|
| Q |
116 |
cccatttgcaattccatcatattattacttgggtgatggct |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43394073 |
cccatttgcaattccatcatattattacttgggtgatggct |
43394113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 111
Target Start/End: Complemental strand, 17547401 - 17547306
Alignment:
| Q |
18 |
aaatttttcgccgtcatcttagtttgagtggataaaggctccataccgttgtagttcatttgcagcaagttccgacagtagta--atagaaaatat |
111 |
Q |
| |
|
|||||| ||| | ||||||| |||| |||||||||||||||||||||| |||||||| ||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
17547401 |
aaatttctcggcttcatcttggtttcagtggataaaggctccataccgccctagttcatctgcggcaggttccagcagtagtaggatagaaaatat |
17547306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University