View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070_low_41 (Length: 235)
Name: NF3070_low_41
Description: NF3070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070_low_41 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 235
Target Start/End: Complemental strand, 39513497 - 39513384
Alignment:
| Q |
122 |
actaaatcacaacacaactttttgtctcaaatatttg--gttgaaaataccaaaatagtcttttgtcgacaaagatttataacaaaatattgttgaatac |
219 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||| | || ||||| ||||||||||||||||||||||||| |||||||| ||| ||| || |||| |
|
|
| T |
39513497 |
actaaataacagcacaactttttgtctcaaatatatattgtcgaaaacaccaaaatagtcttttgtcgacaaaaatttataataaa--attattcaatat |
39513400 |
T |
 |
| Q |
220 |
cataaaaatttatatt |
235 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39513399 |
cataaaaatttatatt |
39513384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 68
Target Start/End: Complemental strand, 39513555 - 39513504
Alignment:
| Q |
17 |
atatcgattaaattttgtcttgtacaatgtttgattgtaaaattgctctatg |
68 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| || ||||||| |
|
|
| T |
39513555 |
atattgattaaattttgtcttgtacaatgtttgatcttaaagtttctctatg |
39513504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 152
Target Start/End: Original strand, 35335972 - 35336004
Alignment:
| Q |
120 |
tcactaaatcacaacacaactttttgtctcaaa |
152 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
35335972 |
tcactaaagcacaacacaactttttgtctcaaa |
35336004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University