View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070_low_43 (Length: 214)
Name: NF3070_low_43
Description: NF3070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 9 - 197
Target Start/End: Complemental strand, 2255649 - 2255460
Alignment:
| Q |
9 |
agcagagagcatgcatagttttgagttatcgaggtgaactgtgtgttacccaccggaccatcctacaaactaa-caggtgaggtgaaagtgtagaaaggg |
107 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
2255649 |
agcatagagcgtgcatagttttgagttatcgaggtgaactgtgtgttacccaccggaccatcctacaaactaagcaggtgaggtgaaagtgtaggaaggg |
2255550 |
T |
 |
| Q |
108 |
ggtacctactgttccattccatttcagtccccggtcaaatagcatgcgtctgttctttgcaggttgatgcgccgttacattcccaccacc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2255549 |
ggtacctactgttccattccatttcagtccccggtcaaatagcatgcgtctgttctttgcaggttgatgcgccgttacattcccaccacc |
2255460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University