View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3070_low_44 (Length: 204)
Name: NF3070_low_44
Description: NF3070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3070_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 20 - 191
Target Start/End: Original strand, 10995630 - 10995801
Alignment:
| Q |
20 |
gtccttgcgttctttaggaaggggattttatgaattctcatttgcctccgaggatgatttacgattggtttgggcgatgggtacggtgaatttgaaacct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
10995630 |
gtccttgcgttctttaggaaggggattttatgaattctcatttgcctccgaggatgatttacgatcggtttgggcgttgggtacggtgaatttgaaacct |
10995729 |
T |
|
| Q |
120 |
ggacttttacggttgttcgaatggactaaagacttcagtatctatacgcaacgtaacactcacgcacaggtt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10995730 |
ggacttttacggttgttcgaatggactaaagacttcagtatctatacgcaacgtaacactcacgcacaggtt |
10995801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 20 - 187
Target Start/End: Complemental strand, 14243464 - 14243297
Alignment:
| Q |
20 |
gtccttgcgttctttaggaaggggattttatgaattctcatttgcctccgaggatgatttacgattggtttgggcgatgggtacggtgaatttgaaacct |
119 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14243464 |
gtccttgtgttctttaggaaggggattttatgaattctcatttgcctccgaggatgatttacgatcggtttgggcgatgggtacggtgaatttgaaacct |
14243365 |
T |
|
| Q |
120 |
ggacttttacggttgttcgaatggactaaagacttcagtatctatacgcaacgtaacactcacgcaca |
187 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14243364 |
ggactgttgcggttgttcgaatggactaaagacttcagtatctatacgcaatgtaacactcacgcaca |
14243297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 29 - 121
Target Start/End: Original strand, 8478304 - 8478396
Alignment:
| Q |
29 |
ttctttaggaaggggattttatgaattctcatttgcctccgaggatgatttacgattggtttgggcgatgggtacggtgaatttgaaacctgg |
121 |
Q |
| |
|
||||||||| ||||| | ||||||||| | |||||||||||||| |||||||||| ||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
8478304 |
ttctttaggtaggggttattatgaattttattttgcctccgaggaagatttacgatcggtttgggcgatgggaacggtaaatttgaaacctgg |
8478396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 20 - 143
Target Start/End: Complemental strand, 19937888 - 19937765
Alignment:
| Q |
20 |
gtccttgcgttctttaggaaggggattttatgaattctcatttgcctccgaggatgatttacgattggtttgggcgatgggtacggtgaatttgaaacct |
119 |
Q |
| |
|
|||| ||| ||||||||| ||||| | ||||||||| | |||||||||||||| |||||||||| ||||||||||||||| ||||| |||||||||||| |
|
|
| T |
19937888 |
gtccctgctttctttaggtaggggttattatgaattttattttgcctccgaggaagatttacgatcggtttgggcgatgggaacggtaaatttgaaacct |
19937789 |
T |
|
| Q |
120 |
ggacttttacggttgttcgaatgg |
143 |
Q |
| |
|
|| | ||| ||||||| |||||| |
|
|
| T |
19937788 |
ggtttgttaaggttgtttgaatgg |
19937765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 187
Target Start/End: Complemental strand, 22982201 - 22982053
Alignment:
| Q |
39 |
aggggattttatgaattctcatttgcctccgaggatgatttacgattggtttgggcgatgggtacggtgaatttgaaacctggacttttacggttgttcg |
138 |
Q |
| |
|
||||| || |||||||||| |||||||| ||||||||| | || |||| |||| ||||| ||||| |||||||| || ||| || | || ||||| | |
|
|
| T |
22982201 |
aggggtttctatgaattcttttttgcctctgaggatgatatgcgcatggtatgggttatggggacggtcaatttgaagcccggagttctccgattgtttg |
22982102 |
T |
|
| Q |
139 |
aatggactaaagacttcagtatctatacgcaacgtaacactcacgcaca |
187 |
Q |
| |
|
||||||| |||||||||| ||| | | |||||||||||||| ||||| |
|
|
| T |
22982101 |
aatggaccaaagacttcaatatgcacaaacaacgtaacactcatgcaca |
22982053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University