View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3071_high_23 (Length: 247)
Name: NF3071_high_23
Description: NF3071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3071_high_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 45 - 231
Target Start/End: Complemental strand, 18237506 - 18237320
Alignment:
| Q |
45 |
gggtcaactagtttttggaggggtcgatggattggtaacattcccttgtgtgagcaatttccgcggttgttctctattccaagatgctagctttagggaa |
144 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18237506 |
gggtcaactaatttttggaggggtcgatggattggtaacattcccttgtgtgagcaatttccgcggttgttctctattccaagatgctaactttagggaa |
18237407 |
T |
|
| Q |
145 |
ttaagggttggacatggtgaagagtgaagttgggcgttgtcatggtgtagaactgtgctcgttgtcattgagggaagacgatgataa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
18237406 |
ttaagggttggacatggtgaagagtgaagttgggcgttgtcatggtgtagaagtttgctcgttgtcattgagggaagacgatgataa |
18237320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 18237579 - 18237533
Alignment:
| Q |
1 |
aagttaacattaagaggaataagaggggggtgagtggtttaaaaggg |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18237579 |
aagttaacattaagaggaataagaggggggtgagtggtttaaaaggg |
18237533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University