View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3071_low_26 (Length: 252)
Name: NF3071_low_26
Description: NF3071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3071_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 45874172 - 45873943
Alignment:
| Q |
1 |
ttcaatcacttgttatattatcttgatctggattgagaagctaaaagttaactaatgagaggaacaaaaattgaannnnnnnggtgttcaattcttatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45874172 |
ttcaatcacttgttatattatcttgatctggattgagaagctaaaagttaactaatgagaggaacaaaaattgaatttttttggtgttcaattcttatga |
45874073 |
T |
|
| Q |
101 |
cgctgtaaaattgatttatagaaatttaatgttacgaaatttgagttcactttctatgttgtttatcacaagacaagatgccattattaatgttttttaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45874072 |
cgctgtaaaattgatttatagaaatttaatgttacgaaatttgagttcactttctatgttgtttatcac-----aagatgccattattaatgttttttaa |
45873978 |
T |
|
| Q |
201 |
tattttatgtatattaggttaagattggtgactta |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45873977 |
tattttatgtatattaggttaagattggtgactta |
45873943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 235
Target Start/End: Complemental strand, 22263542 - 22263514
Alignment:
| Q |
207 |
atgtatattaggttaagattggtgactta |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22263542 |
atgtatattaggttaagattggtgactta |
22263514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 235
Target Start/End: Original strand, 22270298 - 22270326
Alignment:
| Q |
207 |
atgtatattaggttaagattggtgactta |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22270298 |
atgtatattaggttaagattggtgactta |
22270326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University