View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3071_low_27 (Length: 250)
Name: NF3071_low_27
Description: NF3071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3071_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 23 - 234
Target Start/End: Complemental strand, 13006431 - 13006220
Alignment:
| Q |
23 |
cgactgaagagcagctacaatatctttctattattcaagcttatatggttacggagaacaatttgtgttcaaatactacgcgtccactcgagcaacatgt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13006431 |
cgactgaagagcagctacaatatctttctattattcaagcttatatggttacggagaacaatttgtgttcaaatactacgcgtccactcgagcaacatgt |
13006332 |
T |
 |
| Q |
123 |
ccacttatcagtaaactatgagccatatattcaacgctgatgcatgggttgctctcacatcttgttgttaagtctttgtcgatcatccaagtgggataag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13006331 |
ccacttatcagtaaactatgagccatatattcaatgctgatgcatgggttgctctcacatcttgttgttaagtctttgtcgatcatccaagtgggataag |
13006232 |
T |
 |
| Q |
223 |
gtagatatgttt |
234 |
Q |
| |
|
|||||||||||| |
|
|
| T |
13006231 |
gtagatatgttt |
13006220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University