View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3071_low_35 (Length: 233)
Name: NF3071_low_35
Description: NF3071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3071_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 36344927 - 36344747
Alignment:
| Q |
18 |
atatagaccatgattagagtgtgaagtgagtttggttatattacttattaactaatcttcattagagaaaaattattgtggctgttaaataggattccaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36344927 |
atatagaccatgattagagtgtgaagtgagtttggttatattact-attaactaatcttcattggagaaaaattattgtggctgtaaaataggattccaa |
36344829 |
T |
|
| Q |
118 |
ttgtcatgaatatatgtctttccttttgtcctttcatgttattatgttacatttcttttcgtctgtccactttatttcaatg |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36344828 |
ttgtcatgaatatatgtctttctttttgtcctttcatgttattatgttacatttcttttcgtctgtccactttatttcaatg |
36344747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University