View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3071_low_36 (Length: 229)
Name: NF3071_low_36
Description: NF3071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3071_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 213
Target Start/End: Original strand, 1449943 - 1450137
Alignment:
| Q |
19 |
agcaaagctagaaagctccacctaaatgtcttagaagatatatagaagctttatcattcttttattgctgatatatcttccttatttgttcatttgtata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1449943 |
agcaaagctagaaagctccacctaaatgtcttagaagatatatagaagctttatcattcttttattgctgatatatcttccttatttgttcatttgtata |
1450042 |
T |
|
| Q |
119 |
tttaggtttcagcaataatttatgttttgataaattcaagatataaagacaatccaagaaatagttttatgtacaaactgctccgttgtagtttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1450043 |
tttaggtttcagcaataatttatgttttcataaattcaagatataaagacaatccaagcaatagttttatgtacaaactgctccattgtagtttt |
1450137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University