View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3071_low_39 (Length: 221)
Name: NF3071_low_39
Description: NF3071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3071_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 54 - 203
Target Start/End: Complemental strand, 16912167 - 16912018
Alignment:
| Q |
54 |
ctacacgtttctaatgctaagtcgttaagagagcgagagacaatttggatagaagattgtgtaccttgtatagtggtcggaggtaaatttatacaaatga |
153 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||| |
|
|
| T |
16912167 |
ctacaagtttctaatgctaagtcgttaagagagcgagagacaatttggatagaagattgtgtaccttgtatagttgtcggagataaatttgtacaaatga |
16912068 |
T |
 |
| Q |
154 |
gaatatagtttgttgagactcttacagacggaggtttcaataggtgacac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||| |||||||||||| |
|
|
| T |
16912067 |
gaatatagtttgttgagactcttacagacggcgattttaataggtgacac |
16912018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University