View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3074_high_18 (Length: 395)

Name: NF3074_high_18
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3074_high_18
NF3074_high_18
[»] chr4 (3 HSPs)
chr4 (1-83)||(21268748-21268830)
chr4 (323-377)||(21268469-21268523)
chr4 (261-299)||(21268547-21268585)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 5e-32; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 21268830 - 21268748
Alignment:
1 gaaaaatgatacctttgatactgttaaggtgtttggttactttgttagcgcaaccttcgcaatgcatatagactttcaaaacc 83  Q
    ||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
21268830 gaaaaatgatacctttgatgccgttaaggtgtttggtgactttgttagcgcaaccttcgcaatgcatatagactttcaaaacc 21268748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 323 - 377
Target Start/End: Complemental strand, 21268523 - 21268469
Alignment:
323 tgggtcagagtttaatacatgaaaacacaaagaaaacgagtgataatgagtgagt 377  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||    
21268523 tgggtcagagtctaatacatgaaaacacaaagaaaaagagtgataatgagtgagt 21268469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 299
Target Start/End: Complemental strand, 21268585 - 21268547
Alignment:
261 ttatttccaccatttccacccttatttttcttcttctgt 299  Q
    ||||| |||||||||||||||||||||||||||||||||    
21268585 ttattcccaccatttccacccttatttttcttcttctgt 21268547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University