View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_high_20 (Length: 380)
Name: NF3074_high_20
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 19 - 374
Target Start/End: Complemental strand, 34630365 - 34630010
Alignment:
| Q |
19 |
ctttacaatcatatgatgactcaaaccatgtttctcaattctcatcgccatgtgttacagaaaatcatacggaatgatattttcccagttggcaataata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34630365 |
ctttacaatcatatgatgactcaaaccatgtttctcaattctcatcgccatgtgttacagaaaatcatacggaatgatattttcccagttggcaataata |
34630266 |
T |
 |
| Q |
119 |
atgcagtggtatgtatccaagcacatccactcatttcacttgcacttggaatgaggaaataaacttcacgtgtttgcccgcaccatgtgattgtgctgtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34630265 |
atgcagtggtatgtatccaagcacatccactcatttcacttgcacttggaatgaggaaataaacttcacgtgtttgcccgcaccatgtgattgtgctgtt |
34630166 |
T |
 |
| Q |
219 |
ttgtttagtacacctcaaacctgaacatgtcacacccacaatcatcatggcttttgtattgcctatctataattttcatctaacatatatttcaaagttc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34630165 |
ttgtttagtacacctcaaacctgaacatgtcacacccacaatcatcatggcttttgtattgcctatctataattgacatctaacatatatttcaaagttc |
34630066 |
T |
 |
| Q |
319 |
atgctagattgaactaaaattcattaagtaattattgtgtatggttttcatctcac |
374 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
34630065 |
atgctagattgaactaaaattcataaagtaattattgtgtatggttttcatgtcac |
34630010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University