View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_high_32 (Length: 343)
Name: NF3074_high_32
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 35159528 - 35159663
Alignment:
| Q |
1 |
tgaatatgaccgtaggagtattatcaagttgagaaaaactcgaagcatgtactacatcccaaaacaatatatgttactgtgatggtttattgagtttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
35159528 |
tgaatatgaccgtaggagtattatcaagttgagaaaaactcgaagcatgtactacatcccaaaacaatatatgttattttgatggtttattgagtttgat |
35159627 |
T |
 |
| Q |
101 |
ggttgatgcatttgagacatggtttctcaggtgctt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35159628 |
ggttgatgcatttgagacatggtttctcacgtgctt |
35159663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 210 - 333
Target Start/End: Original strand, 35159737 - 35159863
Alignment:
| Q |
210 |
ttacttatgcaatcaatatcaaattcagcggtagtggtttatgagaagaacca---ccaccaaatctcatatcaactttgtccggtggtggtgatgtgtc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35159737 |
ttacttatgcaatcaatatcaaattcagcggcagtggtttatcagaagaaccaccaccaccaaatctcatatcaactttgtcccgtggtggtgatgtgtc |
35159836 |
T |
 |
| Q |
307 |
ttatgacggaacatgtgacaacctatg |
333 |
Q |
| |
|
||||| ||||||||||||||| ||||| |
|
|
| T |
35159837 |
ttatggcggaacatgtgacaatctatg |
35159863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University