View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_high_35 (Length: 325)
Name: NF3074_high_35
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_high_35 |
 | |
|
| [»] scaffold0094 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 30871747 - 30871986
Alignment:
| Q |
1 |
tcactcttgtgggtacacttcgtcaacggtcgatgacatctcatctcaaagaggatctaactcttttcgacttagccgaacttctcacctaggg--attg |
98 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| | || | |
|
|
| T |
30871747 |
tcacttttgtgggtacacttcgtcaacggtcgatgacatctcatctcaaagaggatttaactcttttcgacttagctgaacttctcacctagagtgatcg |
30871846 |
T |
|
| Q |
99 |
aagaatattatgattcaagctctgaaccaaatctaattattttctcttctttattattgtaccctcataggcgtctatttacggggattcaatagcagct |
198 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
30871847 |
aagaatattatgattcaagccccgaaccaaatctaattattttctattctttattattgtaccctcatcggcgtctatttagggggattcaatagcagct |
30871946 |
T |
|
| Q |
199 |
gggtcgtgagagttgaaagatgttcaggctcaagctcaaa |
238 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30871947 |
gggtcatgagagttgaaagatgttcaggctcaagctcaaa |
30871986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 230 - 309
Target Start/End: Complemental strand, 30872113 - 30872034
Alignment:
| Q |
230 |
aagctcaaaaggaaaacgtcatagctgctagcaccacatgtgcttcttcttaatttgctcgaaaagaaagccaatagtta |
309 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30872113 |
aagcccaaaaggaaaaagtcatagctgctagcaccacctgtgcttcttcttaatttgctcgaaaagaaagccaatagtta |
30872034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0094 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: scaffold0094
Description:
Target: scaffold0094; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 55 - 166
Target Start/End: Original strand, 52655 - 52768
Alignment:
| Q |
55 |
atctaactcttttcgacttagccgaacttctcacct--agggattgaagaatattatgattcaagctctgaaccaaatctaattattttctcttctttat |
152 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||| || || ||||| ||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
52655 |
atctaactctttccgacttagccgaacttcacacctggagtgactgaaggatattatgattcaagctctgaaccaaagctaattattttctcttctctat |
52754 |
T |
|
| Q |
153 |
tattgtaccctcat |
166 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52755 |
tattgtaccctcat |
52768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 37 - 90
Target Start/End: Complemental strand, 29859403 - 29859350
Alignment:
| Q |
37 |
catctcatctcaaagaggatctaactcttttcgacttagccgaacttctcacct |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||| |||||||||| |
|
|
| T |
29859403 |
catctcatctcaaagaggatctaactcttttcggcttagtcgagcttctcacct |
29859350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University