View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_high_57 (Length: 275)
Name: NF3074_high_57
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_high_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 27675585 - 27675840
Alignment:
| Q |
1 |
gaatcaaaacgaggataaaatcttaagtattttatttgaaatgacaaaatgcatcaaaattgtccggtcaaatagatgaagtatactaggaactaagtaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27675585 |
gaatcaaaacgaggataaaatcttaagtattttatttgaaatgacaaaatgtatcaaaattgtccggtcaaatagatgaagtatactaggaactaagtaa |
27675684 |
T |
|
| Q |
101 |
tcatctgaaccaataagttatcatatcatgaacaaaaagaatnnnnnnntacctgtccttggatacccatttgcattgcaactattggatctagaatcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27675685 |
tcatctgaaccaataagttatcatatcatgaacaaaaagaataaaaaaatacctgtccttggatacccatttgcattgcaactattggatctagaatcac |
27675784 |
T |
|
| Q |
201 |
tcctcgaattgggcatcccattaggtaagctgaaattttattaggagggaccatgt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27675785 |
ccctcgaattgggcatcccattaggtaagctgaaattttattaggaggggccatgt |
27675840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University