View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_high_72 (Length: 233)
Name: NF3074_high_72
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_high_72 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 30871707 - 30871481
Alignment:
| Q |
1 |
tggtaatcacatagattaggatgatttttgtcaattttggattcttatgtttttgggatagtgttgta------gggttcttagatttcattcaaatggg |
94 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30871707 |
tggtaatcacatagattaggataatttttgtcaattttggattcttatgtttttgggatagtgttgtataagtagggttcttagatttcattcaaatggg |
30871608 |
T |
|
| Q |
95 |
tttgttgaaaattacttaagactttttatttttacagtttgatgccacctaggaagaggcagtatcaaatttgatgatatctgttgcacattttgattta |
194 |
Q |
| |
|
||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30871607 |
ttttttgaaaattacttaagactttctatttttacagtttgatgccacctaggaagaggcagtatcaaatttgatgatatctgttgcacattttgattta |
30871508 |
T |
|
| Q |
195 |
atcaatatgtaattttaacaaaatatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30871507 |
atcaatatgtaattttaacaaaatatt |
30871481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University