View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_low_29 (Length: 365)
Name: NF3074_low_29
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 4 - 349
Target Start/End: Complemental strand, 5125272 - 5124928
Alignment:
| Q |
4 |
gaaaagtatagttaggtgctgaaaatttgatcaaaatgattgtcactgacaatataattgttggcaaaacttcactttagtgtccacaattttctttatg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5125272 |
gaaaagtatagttaggtgctgaaaatttgatcaaaatgattgtcactgacaatataattgttggcaaaactttactttagtgtccacaattttctttatg |
5125173 |
T |
|
| Q |
104 |
ccacatttctcctccactttttatctttatttctctgctcttcataatcttttttgttcatagacttgttgcaagttgttgaggtaagaagataaggaaa |
203 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5125172 |
ccacatttctcctccactttttatttttatttctctgctcttcataatcttttt-gttcatagacttgttgcaagttggtgaggtaagaagataaggaaa |
5125074 |
T |
|
| Q |
204 |
agaatggcatttgcaggaacaactcagaagtgtatggcttgtagcaaaacagtttatcttgttgataagttaactgctgataatagaattttccacaaag |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5125073 |
agaatggcatttgcaggaacaactcagaagtgtatggcttgtaacaaaacagtttatcttgttgataagttaactgctgataatagaattttccacaaag |
5124974 |
T |
|
| Q |
304 |
cttgtttcagatgtcaccactgcaaaggaaccctcaaggtctatgt |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5124973 |
cttgtttcagatgtcaccactgcaaaggaaccctcaaggtctatgt |
5124928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University