View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_low_30 (Length: 361)
Name: NF3074_low_30
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 296
Target Start/End: Complemental strand, 30026039 - 30025768
Alignment:
| Q |
19 |
aatataagctaacatatatcaaagaagtaaagtaaagtgattaataaagataaattatgaagtgcagtgtgagttgaggtgagaggtgggagatggagaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30026039 |
aatataagctaacatatatcaaagaagtaaagtaaagtgattaataaagataaattatgaagtgcagtgtgagttgaggtgagaggtgggagatggagaa |
30025940 |
T |
|
| Q |
119 |
gagcgagaaagaggtgtcaaattcaatttcaatttcaatatcaatatcaaaggtaggaggagtattatgcaagagatgcaagcaaacttataatcctgct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30025939 |
gagcgagaaagaggtgtcaaattcaatttcaat------atcaatatcaaaggtaggaggagtattatgcaagagatgcaagcaaacttataatcctgct |
30025846 |
T |
|
| Q |
219 |
tcaaattcttcaacttcttgccgtttccacccttccttcttcgtatgtcgccgtcacgacgaccaaaaaaggtgacct |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30025845 |
tcaaattcttcaacttcttgccgtttccacccttccttcttcgtatgtcgccgtcacgacgaccaaaaaaggtgacct |
30025768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University