View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_low_39 (Length: 326)
Name: NF3074_low_39
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 457102 - 457277
Alignment:
| Q |
19 |
acagagctagttactaaggttatcatttatcaaggagatcgattgggtggattcggtctagagataggtaaataaaacaaaactgaactcatgaaaatag |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
457102 |
acagagcttgttactaaggttatcatttatcaaggagatcgattgggtggattcggtctagagataggtaaataaaacaaaactgaactcatgaaaatag |
457201 |
T |
|
| Q |
119 |
cttatgaccatgccataagccattttcacaacttctctatactagtatctcaaacgtttatgttaatgcgaaagtt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
457202 |
cttatgaccatgccataagccattttcacaacgtctctatactagtatctcaaacgtttatgttaatgcgaaagtt |
457277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 253 - 314
Target Start/End: Original strand, 457336 - 457397
Alignment:
| Q |
253 |
tgttaagaaagaaacacaatttgatttgatataaccttaccctataattattccacaggttc |
314 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
457336 |
tgttaaaaaagaaacacaatttgatttgatataaccttaccctataattattccccaggttc |
457397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University