View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_low_46 (Length: 317)
Name: NF3074_low_46
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 8e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 26032038 - 26032296
Alignment:
| Q |
1 |
atgcagaggagagtcttggacggcgaagacctctttgtgaacaaaagtgaagggccattcaagagtgtagaagatatctgggaccatgaagattagac-- |
98 |
Q |
| |
|
||||||||||||||| | ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26032038 |
atgcagaggagagtcctcgacggtgaagacctctttgtgaacaagagtgaagggccattcaagagtgtagaagatatctgggaccatgaagattagacaa |
26032137 |
T |
|
| Q |
99 |
-aacacttgcatcatgctactttggttatannnnnnnnnnnnnnnnccttggtttgcaagacacttggtagcattag-tttgatgtactagtagtttata |
196 |
Q |
| |
|
||||||||||||| | |||| || |||| |||| ||||||||| |||||||||||||||| ||| || ||||||||||||||| |
|
|
| T |
26032138 |
taacacttgcatcaagttactgtgtttat-cttttatttcttctttcctttgtttgcaaggcacttggtagcattagttttaatttactagtagtttata |
26032236 |
T |
|
| Q |
197 |
aaaatgagttaagatagcttgtaacacatcaaggtacaagaactctgtaagcacatatttc |
257 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26032237 |
aaaatgagttaagatagctt-ttacacatcaaggtgcaagaactctgtaagcacatatttc |
26032296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University