View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_low_50 (Length: 300)
Name: NF3074_low_50
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 69 - 277
Target Start/End: Original strand, 62251 - 62459
Alignment:
| Q |
69 |
gaggtaattaaaacttgcatatagaaagttcatgtgtataagatatatatatcctgcaaatatatcacctgaatttccatgtgaatagaacacgagagaa |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
62251 |
gaggtaattaaaacttgcatatagaaagttcatgtgtacaagatatatatatcctgcaaatatatcacctgaatttccatgtgaatagaacacgagagaa |
62350 |
T |
|
| Q |
169 |
catcaaaaaccatgagagaccatattatatgcatgagaaatatttattactatgtctttaatttggtaatgagaggacccactttagtatacctaagtaa |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
62351 |
catcaaaaaccatgagagaccatattatatgcatgagaaatatttattactatgtctttaatttggtaatgagaggacccactttagtatacctaagtaa |
62450 |
T |
|
| Q |
269 |
ttaatgtgg |
277 |
Q |
| |
|
||||||||| |
|
|
| T |
62451 |
ttaatgtgg |
62459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University