View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_low_53 (Length: 297)
Name: NF3074_low_53
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 14439576 - 14439296
Alignment:
| Q |
1 |
cctaagagatgttgatattgtggtatgttgtgtttagtggaaatgggtgagtgtggaagatagggttacacaactatgttgggtgaattgggtttcattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14439576 |
cctaagagatgttgatattgtggtatgttgtgtttagtggaaatgggtgagtgtggaagatagggttacacaactatgttgggtcaattgggtttcattc |
14439477 |
T |
 |
| Q |
101 |
gattaacaaaaacgtgcaaaagctctatttggctatgagctagtttctttatcgatagaccacctaaatagatggtttatagtttaatgacgattcaatt |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14439476 |
cattaacaaaaatgtgcaaaagctctatttggctatgagctagtttctttctcggtggaccacctaaatagatgatttatagtttaatgacgattcaatt |
14439377 |
T |
 |
| Q |
201 |
tgacaaactcacatgttctatcataagtttaccgcaccatatcacttatctttctctctttcctcgatcaactagtttcat |
281 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14439376 |
tgacaaattcacatgttctatcataagtttaccgcaccatatcacttatctttctctctttcctcgatcaactagtttcat |
14439296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University