View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_low_57 (Length: 295)
Name: NF3074_low_57
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 18 - 283
Target Start/End: Complemental strand, 46768305 - 46768040
Alignment:
| Q |
18 |
caagggaaacgtgtgatgacggtggagcaattcaagttatggttgaagacaacatttgacacaaaaaatgatggcaaaatcagcaaagaggaactgcgac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46768305 |
caagggaaacgtgtgatgacggtggagcaattcaagttatggttgaagacaacatttgacacaaaaaatgatggcaaaatcagcaaagaggaactgcgac |
46768206 |
T |
 |
| Q |
118 |
atgctgtgcgccttacaagaggactccttgtctcttggagtatatgtccagacttttacgctgcagacaccaatcataacggtttcattgatgacaatga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46768205 |
atgctgtgcgccttacaagaggactccttgtctcttggagtatatgtccagacttttacgctgcagacaccaatcataacggtttcattgatgacaatga |
46768106 |
T |
 |
| Q |
218 |
attcaaaaaccttgtccactttgcagacaagcatttcaatgtcaaaatcaaacagtcctaggtttc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46768105 |
attcaaaaaccttgtccactttgcagacaagcatttcaatgtcaaaatcaaacagtcctaggtttc |
46768040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 27 - 267
Target Start/End: Complemental strand, 46773079 - 46772839
Alignment:
| Q |
27 |
cgtgtgatgacggtggagcaattcaagttatggttgaagacaacatttgacacaaaaaatgatggcaaaatcagcaaagaggaactgcgacatgctgtgc |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| | ||||||||||| |||||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
46773079 |
cgtgtgatgacggtggagcaattcaaactatggttgaagacagcgtttgacacaaacggtgatggaagaatgagcaaagaggaactgcgacatgctgtgc |
46772980 |
T |
 |
| Q |
127 |
gccttacaagaggactccttgtctcttggagtatatg-tccagacttttacgctgcagacaccaatcataacggtttcattgatgacaatgaattcaaaa |
225 |
Q |
| |
|
||||| | ||||||||| ||| ||||||||| | || | ||||||| | ||||||| |||| || ||||||||||||||||| |||||| ||| || |
|
|
| T |
46772979 |
gccttgctagaggactctttgcatcttggagt-tgtgatacagacttcaagtttgcagacgccaaccacaacggtttcattgatgaaaatgaagtcagaa |
46772881 |
T |
 |
| Q |
226 |
accttgtccactttgcagacaagcatttcaatgtcaaaatca |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46772880 |
accttgtccactttgcagacaagcatttcaatgtcaaaatca |
46772839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University