View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_low_63 (Length: 279)
Name: NF3074_low_63
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 20 - 267
Target Start/End: Complemental strand, 595693 - 595446
Alignment:
| Q |
20 |
aattctcacatgatgcaggcagggatttgcagcggttgtctggaaacactagttctagagttggttacatgagctcaaaacaggtgacacttgaacatca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
595693 |
aattctcacatgatgcaggcagggatttgcagcggttgtctggaaacactagttctagagttggttacatgagctcaaaacaggtgacacttgaacatca |
595594 |
T |
 |
| Q |
120 |
tttattgtcttctattagttagttttgttagcatatgtgttttcagtttgtcaattaggtgtataaaattactagtggaagacatacttaagaatgtttt |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
595593 |
tttattgtcttcaattagttagttttgttatcatatgtgttttcagtttgtcaattaggtgtataaaattactagtggaagacatacttaagaatgtttt |
595494 |
T |
 |
| Q |
220 |
tgaagtttcaatatattcaaggactacactgaaaccacctcatatatt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
595493 |
tgaagtttcaatatattcaaggactacactgaaaccacctcatatatt |
595446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University