View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_low_68 (Length: 251)
Name: NF3074_low_68
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_low_68 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 46788030 - 46787791
Alignment:
| Q |
12 |
acagatgttacatttttgtcattgcttcatgcttgcagtcatgcaggattagtcgagaaaggtatggagcttttggaatctatgactaatgatcacggta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46788030 |
acagatgttacatttttgtcattgcttcatgcttgcagtcatgcaggattagtcgagaaaggtatggagcttttggaatctatgactaatgatcacggta |
46787931 |
T |
 |
| Q |
112 |
taagtcctcggtcagaacattatgcctgcgttgtcgacatgttgggcagggcaggacatcttaatgaagctaagaaattcattgagggattgcctgagca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46787930 |
taagtcctcggtcagaacattatgcctgcgttgtcgacatgttgggcagggcaggacatcttaatgaagctaagaaattcattgagggattgcctgagca |
46787831 |
T |
 |
| Q |
212 |
tggtggtgttttagtctggcaagcattgcttggtgcttgt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46787830 |
tggtggtgttttagtctggcaagcattgcttggtgcttgt |
46787791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University