View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_low_72 (Length: 250)
Name: NF3074_low_72
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_low_72 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 43488705 - 43488467
Alignment:
| Q |
12 |
aagaaaggtggtgggcttgctagaagttcaagttgcattcctgctattacaagagatatcaatgatttcacaatcaccaattaatcttatcttataacat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43488705 |
aagaaaggtggtgggcttgctagaagttcaagttgcattcctgctattacaagagatatcaatgatttcacaatcaccaattaatcttatcttataacat |
43488606 |
T |
|
| Q |
112 |
agaagttaaccgtatgtttgaattgatggtaagtttaatagaatctcagtgagtcaccgtaattttattcaataatattacggtaagaccaccatgattt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
43488605 |
agaagttaaccgtatgtttgaattgatggtaagtttaatagaatctcagcgagtcaccgtaattttattcaataatattacggtgagaccatcatgattt |
43488506 |
T |
|
| Q |
212 |
caccaactcaacgtgatttcagacatgcattaagtgttt |
250 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43488505 |
catcaactcaacgtgatttcagacatgcattaagtgttt |
43488467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University