View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_low_75 (Length: 240)
Name: NF3074_low_75
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_low_75 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 8807599 - 8807375
Alignment:
| Q |
1 |
tccattctacatcaacaacacttcatgtgcttcattgtcaagttctttccacctctcttgctcaaattcatccacccttttgatcaaaataggttcacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807599 |
tccattctacatcaacaacacttcatgtgcttcattgtcaagttctttccacctctcttgctcaaattcatccacccttttgatcaaaataggttcacaa |
8807500 |
T |
|
| Q |
101 |
aactatcccattttggaattcttttcagatggtttgttagtagactttccaggaacctcatcgtgtcgacagtacaacgatttgaattcatttggtgaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807499 |
aactatcccattttggaattcttttcagatggtttgttagtagactttccaggaacctcatcgtgtcgacagtacaacgatttgaattcatttggtgaga |
8807400 |
T |
|
| Q |
201 |
ggagttttgatggaagaaactactt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8807399 |
ggagttttgatggaagaaactactt |
8807375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 64 - 212
Target Start/End: Complemental strand, 22923937 - 22923789
Alignment:
| Q |
64 |
aaattcatccacccttttgatcaaaataggttcacaaaactatcccattttggaattcttttcagatggtttgttagtagactttccagga-acctcatc |
162 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||| || ||| ||||||| | |||| ||||||||||||||||| |||| || || || |
|
|
| T |
22923937 |
aaattcatctacccttttgaacaaaataggttcacaaaactatcttatcttgaaattcttcttagattgtttgttagtagacttt-taggatacatcgtc |
22923839 |
T |
|
| Q |
163 |
gtgtcgacagtacaacgatttgaattcatttggtgagaggagttttgatg |
212 |
Q |
| |
|
||||||| |||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
22923838 |
atgtcgacgatacaacgatttgaatttatttgaagagaggagttttgatg |
22923789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University