View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_low_77 (Length: 238)
Name: NF3074_low_77
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_low_77 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 148 - 221
Target Start/End: Complemental strand, 43487913 - 43487840
Alignment:
| Q |
148 |
aaacaatcaaaataaaatagatagaagtataatatatgtatacatgaataaagtttgcaactgtggtggatctt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
43487913 |
aaacaatcaaaataaaatagatagaagtataatatatgtatacacgaataaaatttgcaactgtggtggatctt |
43487840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 43488060 - 43487999
Alignment:
| Q |
1 |
taccaaacccaagagagaaataccgtggcttagaagttagttgtgacctttttattaaaagg |
62 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43488060 |
taccaaacccaagagagaaattccgtggcttagaagttagttgtgacctttttattaaaagg |
43487999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University