View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3074_low_83 (Length: 215)
Name: NF3074_low_83
Description: NF3074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3074_low_83 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 17977116 - 17976933
Alignment:
| Q |
18 |
gtcttctcagcaacgccttgttgatcagaaaatctggcagtgctgtgcaggcagttccgttaaaattccaaaactatattctcatgtttactacttccca |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17977116 |
gtcttctcagcaacgccgtgttgatcagaaaatctggcagtgctgtgcaggcagttccgttaaaattccaaaactatattctcatgtttactacttccca |
17977017 |
T |
|
| Q |
118 |
ttagggcacttagaacacgtctctccatccccaaaccctagcacactctcccttcttgacagttcccgtccattcattctctgc |
201 |
Q |
| |
|
|||||||||||||||||| | | ||||||||||||||||| |||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
17977016 |
ttagggcacttagaacacatatgtccatccccaaaccctaacacactgtcccatcttgaccgttcccgtccattcattctctgc |
17976933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 36 - 201
Target Start/End: Original strand, 17914064 - 17914229
Alignment:
| Q |
36 |
tgttgatcagaaaatctggcagtgctgtgcaggcagttccgttaaaattccaaaactatattctcatgtttactacttcccattagggcacttagaacac |
135 |
Q |
| |
|
|||||||| ||||||||||||||||| || ||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17914064 |
tgttgatccaaaaatctggcagtgctgcgccggcgctgccgttaaaattccaaaactaaattctcatgtttactacttcccattagggcacttagaacac |
17914163 |
T |
|
| Q |
136 |
gtctctccatccccaaaccctagcacactctcccttcttgacagttcccgtccattcattctctgc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
17914164 |
gtctctccatccccaaaccctagcacactctcccttcttgaccgttcccgtcaattcattccctgc |
17914229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University