View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3078_high_12 (Length: 333)
Name: NF3078_high_12
Description: NF3078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3078_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 36957654 - 36957788
Alignment:
| Q |
1 |
acaccatttacaattatgattggagttagatttcctatgccctgtctactaattgaggagttttcttttacattgaaagaatatcaacactagttgacat |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
36957654 |
acaccatttacaattataattggagttagatttcctatgccctgtctactagttgaggagtttt-ttttacattgaaagaatatcaacactggttga--- |
36957749 |
T |
 |
| Q |
101 |
gcatggtgctaagattctaaaattctatgctctcataatt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36957750 |
-catggtgctaagattctaaaattctatgctctcataatt |
36957788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 172 - 319
Target Start/End: Original strand, 36957783 - 36957947
Alignment:
| Q |
172 |
ataattacaacagtaggtagcttatgcagctcttacaatgtagaggctactgtaactgaattgcgatgtccaaa----------------aaactaacag |
255 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
36957783 |
ataattacaacagtagctagcatatgcagctcttacaatgtagaggctactgtaactgaattgcgatgtccaaaatactgactttaacataatctaacag |
36957882 |
T |
 |
| Q |
256 |
cttattgcctagttagcactagattaactagcttggaatgatct-ggaatattctagaatgatct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36957883 |
cttattgcctagttagcactagattaactagcttggaatgatctgggaatattctagaatgatct |
36957947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University