View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3078_high_14 (Length: 315)
Name: NF3078_high_14
Description: NF3078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3078_high_14 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 43 - 315
Target Start/End: Complemental strand, 43075523 - 43075249
Alignment:
| Q |
43 |
attaatttatcatcatgtaaatgactaatttagttgtttttgtggagacaaaattgagtctnnnnnnntgtgagaaataaaaatgtctatattttgaaaa |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43075523 |
attaatttatcatcatgtaaatgactaatttagttgtttttgtggagacaaaattgagtctaaaaaaatgtgagaaataaaaatgtctatattttgaaaa |
43075424 |
T |
 |
| Q |
143 |
gtttatgacaacaataataacaattaatacggttctgtgttttcttcttgccatgtctctgtca--nnnnnnnnnnnntctcaactcatcagaacagaac |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43075423 |
gtttatgacaacaataataacaattaatacggttctgtgttttcttcttgccatgtctctgtcaacacacacacacacactcaactcatcagaacagaac |
43075324 |
T |
 |
| Q |
241 |
catatttgtactcactctctatactctttgaggattgttccttctttcttatctttgctttaaatctcccatcat |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43075323 |
catatttgtactcactctctatactctttgaggattgttccttctttcttatctttgctttaaatctcccatcat |
43075249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University