View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3078_high_19 (Length: 278)
Name: NF3078_high_19
Description: NF3078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3078_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 51827566 - 51827819
Alignment:
| Q |
1 |
caggacagattctttgatatggtgagtagacagtaactctgcaaacacaacataagaaaataataatatcataagtaataaataacaagaggcaaatcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51827566 |
caggacagattctttgatatggtgagtagacagaaactctgcaaacacaacataagaaaataataatatcataagtaataaataacaagaggcaaatcaa |
51827665 |
T |
 |
| Q |
101 |
tttgcacaatgaactagaatctagattaagaatttttaatactaagaaaatgacatgataaattt-cagtcacaaaaaagccagatttatgttatgcatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51827666 |
tttgcacaatgaactagaatctagattaag-atttttaatactaagaaaatgacatgataaatttccagtcacaaaaaagccagatttatgttatgcatg |
51827764 |
T |
 |
| Q |
200 |
cttcaccaaaagctc-caaaaatgttcaatccaaattagttgatgttgaatttac |
253 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51827765 |
cttcaccaaaagctcaaaaaaatgttcaatccaaattagttgatgttgaatttac |
51827819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 79 - 156
Target Start/End: Original strand, 51824422 - 51824498
Alignment:
| Q |
79 |
taaataacaagaggcaaatcaatttgcacaatgaactagaatctagattaagaatttttaatactaagaaaatgacat |
156 |
Q |
| |
|
||||||||||||||| || |||||||||||||| |||||||| | |||||| ||||| ||||||||||||||||| |
|
|
| T |
51824422 |
taaataacaagaggccaaccaatttgcacaatggactagaattaaaattaag-attttctttactaagaaaatgacat |
51824498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University