View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3078_high_23 (Length: 247)
Name: NF3078_high_23
Description: NF3078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3078_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 94 - 212
Target Start/End: Original strand, 41398926 - 41399047
Alignment:
| Q |
94 |
taggatgcttcctggtagcatc---gtagcgccacagtagaaagacgcactctcactcattattcattcacatttcttttctctatatataccctttttc |
190 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41398926 |
taggatgcttcctagtagcatcatcgtagcgccacagtagaaagacgcacactcactcattattcattcacatttcttttctctatatataccctttttc |
41399025 |
T |
 |
| Q |
191 |
tactcaacttagacaaacacca |
212 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41399026 |
tactcaacttagacaaacacca |
41399047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 41398833 - 41398873
Alignment:
| Q |
1 |
cggaatagaatattcaaaccgcaaagatagaatttatcaac |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41398833 |
cggaatagaatattcaaaccgcaaagatagaatttatcaac |
41398873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 94 - 152
Target Start/End: Original strand, 41406030 - 41406088
Alignment:
| Q |
94 |
taggatgcttcctggtagcatcgtagcgccacagtagaaagacgcactctcactcatta |
152 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
41406030 |
taggatgcttcctagtagcatcgtagaaccacagttgaaagtcgcactctcactcatta |
41406088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University