View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3078_low_22 (Length: 294)
Name: NF3078_low_22
Description: NF3078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3078_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 11 - 174
Target Start/End: Original strand, 4198476 - 4198639
Alignment:
| Q |
11 |
cagagagatggcaaaattttattcctgaccttgttttggcagcgaagagtaatgaaactatttgtgagaattttatggttatattgaagcttttgaatga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4198476 |
cagagagatggcaaaattttattcctgaccttgttttggcagcgaagagtaatgaaactatttgtgagaattttatggttatattgaagcttttgaatga |
4198575 |
T |
 |
| Q |
111 |
agaggnnnnnnnnnnnncaagaggagagatgactcagcagaagattaaagagcttaaactatca |
174 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4198576 |
agaggtttttgatttttcaagaggagagatgactcagcagaagattaaagagcttaaactatca |
4198639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 190 - 277
Target Start/End: Original strand, 4198629 - 4198716
Alignment:
| Q |
190 |
ttaaactatcattgaatggtgagtttcagcttatatataatttatgcttatgtgttatgggtttcccaacgaaccgagcttatgtgtg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||||| |||| |
|
|
| T |
4198629 |
ttaaactatcattgaatggtgagtttcagcttatatataatttatggttatgtgttatggttttcccaacgaacagagcttatatgtg |
4198716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 15 - 99
Target Start/End: Original strand, 1519546 - 1519630
Alignment:
| Q |
15 |
gagatggcaaaattttattcctgaccttgttttggcagcgaagagtaatgaaactatttgtgagaattttatggttatattgaag |
99 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| ||||| |||| | |||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
1519546 |
gagatggcgaaactttattcctgaccttgtttcagcagctaagaccagtgaaactatttgtgagaattgtatggctatattgaag |
1519630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 128 - 174
Target Start/End: Original strand, 1519730 - 1519776
Alignment:
| Q |
128 |
caagaggagagatgactcagcagaagattaaagagcttaaactatca |
174 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
1519730 |
caagaggcgagatgactcagctgaagattaaagagcttaaacaatca |
1519776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 128 - 174
Target Start/End: Complemental strand, 29749728 - 29749682
Alignment:
| Q |
128 |
caagaggagagatgactcagcagaagattaaagagcttaaactatca |
174 |
Q |
| |
|
|||||||||| ||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
29749728 |
caagaggagaaatgacacagcagaagataaaagagcttaaacaatca |
29749682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University