View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3078_low_24 (Length: 281)
Name: NF3078_low_24
Description: NF3078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3078_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 4 - 256
Target Start/End: Original strand, 49918400 - 49918646
Alignment:
| Q |
4 |
attgcaatggatgatatgtcagcaatttgtctcttctttcatcacctcccacacactaaagctgttgattaagattaataagaattgttaattgcttcct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49918400 |
attgcaatggatgatatgtcagcaatttgtctcttctttcatcaactcccacacactaaagcttttgattaagattaagaagaattgttaattgcttcct |
49918499 |
T |
 |
| Q |
104 |
tatatatgacacagacagatttgttgtatctatattctctt-gacactactatttaaaattatgtaaatgaattatgagactcactcctatatgctgtga |
202 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49918500 |
tatatatgac----acagatttgttgtatctatattctcttagacactactatttaaa---atgtaaatgaattatgagactcactcctatatgctgtga |
49918592 |
T |
 |
| Q |
203 |
cagttccagccgttacaggctatataccttcttaaaatgaaatttagagaaaat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49918593 |
cagttccagccgttacaggctatataccttcttaaaatgaaattcagagaaaat |
49918646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University