View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3078_low_25 (Length: 279)
Name: NF3078_low_25
Description: NF3078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3078_low_25 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 168 - 279
Target Start/End: Complemental strand, 42336769 - 42336658
Alignment:
| Q |
168 |
gaaggagtggttgtatcttttataaataaattataaatggattgaaatggaagttaataaatggagcaaaccgtacgcggttaaaacatttaagaattgt |
267 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42336769 |
gaaggagtgtttgtatcttttataaataaattataaatggattgaaatggaagttaataaatggagcaaaccgtacgcggttaaaacatttaagaattgt |
42336670 |
T |
 |
| Q |
268 |
tcccaatctgtg |
279 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42336669 |
tcccaatctgtg |
42336658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 62 - 137
Target Start/End: Complemental strand, 42336878 - 42336803
Alignment:
| Q |
62 |
attacgatgattgttttgagtattaaaatgtgtctactaattannnnnnngacgggtaaaatgggtctactaggta |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42336878 |
attacgatgattgttttgagtattaaaatgtgtctactaattatatttttgacgggtaaaatgggtctactaggta |
42336803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University