View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3078_low_25 (Length: 279)

Name: NF3078_low_25
Description: NF3078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3078_low_25
NF3078_low_25
[»] chr5 (2 HSPs)
chr5 (168-279)||(42336658-42336769)
chr5 (62-137)||(42336803-42336878)


Alignment Details
Target: chr5 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 168 - 279
Target Start/End: Complemental strand, 42336769 - 42336658
Alignment:
168 gaaggagtggttgtatcttttataaataaattataaatggattgaaatggaagttaataaatggagcaaaccgtacgcggttaaaacatttaagaattgt 267  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42336769 gaaggagtgtttgtatcttttataaataaattataaatggattgaaatggaagttaataaatggagcaaaccgtacgcggttaaaacatttaagaattgt 42336670  T
268 tcccaatctgtg 279  Q
    ||||||||||||    
42336669 tcccaatctgtg 42336658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 62 - 137
Target Start/End: Complemental strand, 42336878 - 42336803
Alignment:
62 attacgatgattgttttgagtattaaaatgtgtctactaattannnnnnngacgggtaaaatgggtctactaggta 137  Q
    |||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||    
42336878 attacgatgattgttttgagtattaaaatgtgtctactaattatatttttgacgggtaaaatgggtctactaggta 42336803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University