View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3078_low_32 (Length: 245)
Name: NF3078_low_32
Description: NF3078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3078_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 12769236 - 12769444
Alignment:
| Q |
12 |
gcacagaccaattcatgcacggaacatatatataaattaaggttaggtgataggtcattgtttcaactctcttctaaataaactagggattatatagtga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12769236 |
gcacagaccaattcatgcacggaacatatgtataaatcatggttaggtgataggtcattgtttcaactctcttctaaataaactagggattatatagtga |
12769335 |
T |
|
| Q |
112 |
ttaaaatgtagcaatttagaatgcaacaatttggaaaattagggaagttccaagggaggttattttttcttccaaaatttaggaggggggagattgcagc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
12769336 |
ttaaaatgtagcaatttagaatgcaacaatttggaaaattagggaagttctaagggaggttattttttcttccgaaatttaggaggggggagattgccgc |
12769435 |
T |
|
| Q |
212 |
ctcctcgag |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
12769436 |
ctcctcgag |
12769444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 67
Target Start/End: Original strand, 12780919 - 12780962
Alignment:
| Q |
24 |
tcatgcacggaacatatatataaattaaggttaggtgataggtc |
67 |
Q |
| |
|
||||||| ||||||||||||||||| || ||||||||||||||| |
|
|
| T |
12780919 |
tcatgcatggaacatatatataaatcaaagttaggtgataggtc |
12780962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University