View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3079_high_1 (Length: 256)
Name: NF3079_high_1
Description: NF3079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3079_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 20 - 126
Target Start/End: Complemental strand, 40115947 - 40115841
Alignment:
| Q |
20 |
aacttgtttaaaataataatacagttgaagattaacttaaaagtggattatatagataaagaacaattcgatggtttactataattgaaattgaagcgga |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40115947 |
aactagtttaaaataataatacagttgaagattaacttaaaagtggattatatagacaaagaccaattcgatggtttactataattgaaattgaagcgga |
40115848 |
T |
 |
| Q |
120 |
agttaag |
126 |
Q |
| |
|
||||||| |
|
|
| T |
40115847 |
agttaag |
40115841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 164 - 238
Target Start/End: Complemental strand, 40115802 - 40115728
Alignment:
| Q |
164 |
gacggattgtggctacttattgaccatgttgtggagatgttccaaaatatgaccacgtcaaccatttaagttttc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40115802 |
gacggattgtggctacttattgaccatgttgtggagatgttccaaaatatgaccacgtcaaccatttaagttttc |
40115728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University