View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3079_low_6 (Length: 237)
Name: NF3079_low_6
Description: NF3079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3079_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 40115547 - 40115330
Alignment:
| Q |
1 |
agttgtacaaatatcatttctcttcttgtaatgtctagaaccctttgttctttcactatattttacttttttaagcaaaataatatactttgacatcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40115547 |
agttgtacaaatatcatttctcttcttttaatgtctacaacccttagtcctttcactatattttacttttttaagcaaaataatatactttgacatcatt |
40115448 |
T |
 |
| Q |
101 |
-ttttacacttgtgcgacatgtatttaatcatgtttaaaaatatgattagcttagtgtaatatatgattatttttacacatgattaatgattaattcaac |
199 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40115447 |
tttttacacttgtgcgacatctatttaatcatgtttaaaaatatgattagcttagtgtaatatatgattattttt----atgattaatgattaattcaac |
40115352 |
T |
 |
| Q |
200 |
catatagattcaccaaaatttt |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40115351 |
catatagattcaccaaaatttt |
40115330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 7867761 - 7867793
Alignment:
| Q |
1 |
agttgtacaaatatcatttctcttcttgtaatg |
33 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
7867761 |
agttgtacaaatatcatttctctttttgtaatg |
7867793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University